Questions tagged as 'c++'

Tagged questions
1
answer

How to read a string of a file character by character and store it within a vector c ++

Hello everyone, my problem is that I have a chain of this style. Every time I run my program the chain changes because it is random. CGGACCCGTGGTCCGAGGTCTAAAGTGATTAGAAGCCGGT The question is that I must read character by character back and...
asked by 06.12.2017 / 17:57
2
answers

Name a variable by a user in c ++

Good morning; Only one question that I have been asking for a long time. In a c ++ program we can declare a variable with a name in a very simple way, for example: int operando_one; However, my question is whether you can give that name...
asked by 10.06.2017 / 07:40
1
answer

cpp SOCK_RAW continues to receive the same message ad infinitum

I create a socket of the form: fd = socket(AF_INET, SOCK_RAW, IPPROTO_UDP); then proceed: bind(fd, (struct sockaddr*)&saddr, sizeof(struct sockaddr_in)) where saddr supports INADDR_ANY and is from the AF_INET family The problem...
asked by 05.12.2017 / 14:30
1
answer

crash in accumulator of a vector?

I'm just starting programming and I have to do a dice game, the problem is that when I want to build an accumulator to know how many times each number is repeated, it creshes or reports false numbers I know it must be something ve...
asked by 01.12.2017 / 22:10
1
answer

Problems .bin files in C ++

I want to make an agenda-type program in which I can save my contacts in a .bin file. The problem is that when I run the crashea program. This is the part that reads the .bin: ifstream entrada; entrada.open(Archivo,ios::binary); Con...
asked by 19.11.2017 / 02:33
0
answers

Referenced objects and pointers of a class

I have a program that has to create a tree from a graph, for that I have the following code: NodoArbol<Vertice>* GrafoMatriz::getBP(bool AR, string origen){ int num_pf=1; int indiceV = this->getIndicePorNombre(origen); Nodo&l...
asked by 10.11.2017 / 05:05
1
answer

Unresolved external symbol What have I done wrong?

I've been trying to solve a problem for a while, I've tried to solve it with different compilers and there's no way. The program is more complex but I have been able to summarize it in the following code: S.hpp #ifndef S_HPP #define S...
asked by 16.05.2017 / 22:48
0
answers

I need to connect a PHP with QT c ++

I'm doing a registry of users, and also a login, in QT with c ++, I just created a php which I have hosted in a hosting, where I have the database, which is not how to send the data that register the user in my application, send it to the online...
asked by 05.11.2017 / 05:37
0
answers

Help with a map made with arrangements and classes c ++

I am doing a program with a ship in which you must move on the screen but I must add a map which must be a box stuck to the left and another to the right and that the ship has a space to pass through and must be done with a class and arrangement...
asked by 01.11.2017 / 05:38
1
answer

error when compiling binding to reference of type discards qualifiers

when executing a program in which among other functions, I minimize a finite deterministic automaton (DFA, for more information, link ), I use the set and map containers of the C ++ stl, but it gives me errors that I do not understand in that f...
asked by 29.10.2017 / 22:05