Questions tagged as 'string'

Tagged questions
3
answers

remove non-alphanumeric characters in r

I have a function in r that analyzes them from different text strings and returns all the words that contain the different strings. data <- searchTwitter(input$select, n=input$numtweets) data_text <- sapply(data, function(x) x$getText())...
asked by 18.05.2017 / 10:57
1
answer

like reading a txt file in java and passing it to an array

I have the following code in java to read a txt file // recibe la dirección del archivo public String leerTxt (String direccion){ String texto=""; try { BufferedReader bf= new BufferedReader(new FileR...
asked by 05.05.2017 / 00:35
1
answer

How to put local -portable- database in c # (visual studio 2015, sql server compact)?

I was doing a system in c # , I had it connected to a database in access . But I realized that maybe I could not; Generate the installer of the program and pass it to another person. Someone told me to try to put a database of Sql Server Comp...
asked by 08.06.2016 / 03:49
1
answer

android coin converter

I have been asked to create a currency converter and I did it, but when I give it to execute a conversion of 1 US dollar to euro I get this: for 1 US dollar, you will receive 1 euro Even if I try to convert 2 dollars to euro I get it fo...
asked by 20.11.2018 / 06:20
1
answer

how to relate pointers to char with Strings

Good afternoon I need some help to get closer to my solution, in C when it is executed by console and files are included these are declared in the main statement with a pointer to char pointers (array of Strings) but then I need to store those v...
asked by 05.05.2018 / 16:44
3
answers

Use ArrayList to save data of different value

I'm trying to save different types of data in an arraylist, mainly String and int to have a database of people. After looking for ways to do it, I decided to create a separate class. class Persona { private String nombre; private int...
asked by 04.05.2018 / 15:39
1
answer

Problem trying to order a string vector inherited from VectorString

I have a VecCadenas class that inherits from Vector<String> : public class VecCadenas extends Vector<String> I want to sort the vector (which is assembled in the constructor from a line-by-line text file), I can ver...
asked by 12.05.2018 / 14:11
1
answer

error recorer string with for in r

I want to go through a text string using a loop, but when I run the code, it only makes the first iteration. text <- "CTGGTGCTCGTAGACCGCAGAACC"; i=0 i1=i+3 for (i in 1:length(text)){ DNA <-substr(text,i,i1) i=i1+1 i1=i+2 print(DNA) }...
asked by 27.10.2017 / 10:26
1
answer

Separate characters from a char to enclose each one in different variables

You see, I'm using Borland C ++ ver 5.02 (I know it's an old compiler but I'd still like to know if there's a way to end my delirium) I need my program to read the char characters and separate them into different variables afterwards of a comma,...
asked by 18.03.2018 / 06:02
1
answer

Using preg_match_all () in an Array (Notice: Array to string conversion in) php

I'm looking for help to resolve the message:    Notice: Array to string conversion in <?php $response = '{"data":[{"access_token":"EAAby7f21xKABALPCThZC63i4LZAHZC7MaYbQ0E5gN","id":"515968102105625"},{"access_token":"EAAby7f21xKABAK0zyf...
asked by 17.11.2017 / 06:02